Dietary resveratrol improved production performance, egg quality, and intestinal health of laying hens under oxidative stressRESVERATROL IN LAYING HENS

999

Abstract

Resveratrol (RV) is associated with protection against oxidative stress to improve health, however the effect of RV in layers under oxidative stress (OS) is limited. The objective of this experiment was to investigate the negative effect of OS and protective effects of RV against OS in laying hens. 40 Lohmann layers (25-wk-old; BW = 1.44±0.10 kg) were allocated to four treatments in a 2 × 2 factorial arrangement with either RV (0 or 600 mg/kg) or intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW) for 31 days. The results shown that the hens challenged with tBHP presented lower egg-laying rate, feed intake, feed efficiency and higher defective egg rate (P(tBHP)<0.05). The RV were also observed to attenuated egg laying rate and feed intake reduction together with decreased broken egg rate under t-BHP challenge (P(Interaction)≤0.01). Eggshell quality (color, strength, thickness), albumen quality (albumen height, Haugh unit, albumen relative weigh) and yolk color were lower in tBHP challenge (P(tBHP)<0.05). The RV were observed to increase eggshell color (lower lightness, higher redness and yellowness values), yolk color and albumen relative weight under tBHP challenge (P(Interaction)<0.05). A decrease in the serum concentration of estradiol, follicle-stimulating hormone (FSH), anti-Müllerian hormone (AMH) and leptin were observed in the tBHP challenged layers (P(tBHP)<0.05). Feeding RV were found to increase FSH levels irrespective of tBHP challenge (P(RV)<0.05), while the increase in serum estradiol, AMH and leptin concentration were more pronounced when layers received RV diet under tBHP challenge (P(Interaction)<0.05). The tBHP challenged layer demonstrated lower intestinal morphology (villus height in duodenum and jejunum), lower antioxidant enzymes activities [total superoxidase (SOD), glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC)], and glutathione (GSH) levels and higher malondialdehyde (MDA) level] (P(tBHP)<0.05). Dietary RV increased jejunal SOD, GSH-Px and T-AOC activities, and reduced MDA concentration (P(RV) ≤0.05). Layers under tBHP challenge up-regulated mRNA expression of pro-inflammatory cytokine [interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α)] and nuclear factor NF-κB (P(tBHP)<0.05) in jejunum. Dietary RV supplementation down-regulated mRNA gene expression of IL-1β, IL-6, TNF-α and NF-κB (P(RV) ≤0.05). Moreover, layers under t-BHP challenge had lower mRNA expression of barrier-related proteins (claudin-1, claudin-2, mucin-1, and occludin) (P(tBHP)<0.05) in jejunum mucosa. Dietary RV up-regulated mRNA expression of jejunal barrier-related proteins (claudin-1, claudin-2, mucin-1, and occludin) and ovarian reproductive hormone receptor [steroidogenic acute regulatory protein (StAR), androgen receptor (AR), estrogen receptor 1 (ESR1), and activin a receptor type 1 (ACVR1)] (P(RV) ≤0.05). Overall, the results indicate that tBHP induced oxidative stress to result in reducing production performance, egg quality, intestinal health and induced ovarian inflammation; whereas dietary RV was able to maintain intestinal health and mitigate the negative impact of tBHP challenge on production performance and egg quality.

Keywords

Resveratrol
laying hens
egg quality
antioxidant capacity
ovary function

INTRODUCTION

Oxidative stress is a phenomenon caused by an imbalance between production and accumulation of oxygen reactive species (ROS) in cells and tissues. Oxidative stress has been proven to be linked to internal mechanism for many environmental stressors (i.e., UV, ionizing radiations, pollutants, and heat stress), xenobiotics (mycotoxins, heavy metals, pesticides, etc.), health disorders and aging (Pizzino et al., 2017; Liguori et al., 2018; Wang et al., 2019; Liu et al., 2021a; Liu et al., 2021b; Wang et al., 2021b). Moreover, it has been proved that oxidative stress plays a role in follicular atresia to lead to ovarian aging and reproductive disorders (Gupta et al., 2006; Devine et al., 2012; Shen et al., 2012). Serval previous studies has shown that oxidative stress could led to reduction in production performance and intestinal health (Mishra and Jha, 2019; Wang et al., 2019; Li et al., 2020; Wang et al., 2021b).

Resveratrol (trans-3, 5, 40-trihydroxytilbene; RV) is a naturally polyphenol compound found in berries, nuts, skins of grapes and thus in red wine (Jiang et al., 1997). RV has antioxidant, antitumor, antiviral, and free radical scavenging properties, that is thought to be an effective compound for the prevention aging and age-related diseases (Nunes et al., 2018; Li et al., 2018; Zhou et al., 2021). Also, RV is associated with protection against oxidative stress of ovary to increase follicle numbers and prolong the ovary life-extending effect in human and rat model (Liu et al., 2013; Li and Liu, 2018; Ochiai and Kuroda, 2019). Literature has shown that RV improved production performance, egg quality (extend egg shelf life, sensory score, egg quality) and antioxidant capacities of laying hens (Feng et al., 2017; Zhang et al., 2019). However, the response of layers to oxidative stress and protecting effect of RV on production performance, intestinal and ovarian function is not clear.

Therefore, the purpose of the current study was to verify the hypothesis that dietary resveratrol supplementation could attenuate the production performance, egg quality, intestinal health and ovarian function of laying hens under oxidative stress.

MATERIALS AND METHODS

The experiment was carried out according to the Chinese guidelines for animal Welfare and approved by the Animal Care and Use Committee of Sichuan Agricultural University.

Birds, Experiment Design, and Management

A total of 40 Lohmann gray hens (25 wk of age; initial BW = 1.44±0.10 kg) with similar performance, were randomly assigned to four treatments with 10 replicates of 1 hen. All laying hens were were randomly allotted into a 2 by 2 factorial design that were dietary supplementation either resveratrol (0 or 600 mg/kg) or intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW) for 28 days (The dosage of tBHP were set according to the previous study) (Wang et al., 2021b). Resveratrol (≥ 99%) and tBHP (≥ 99%) were purchased from Sigma-Aldrich Corp (St Louis, MO, USA). All diets were formulated to meet nutrient specifications according to the NRC (1994) recommendations for all nutrients in a mash form. Layers were allowed ad libitum access to water and feed. Hens were housed individually in a cage equipped with 2 nipple drinkers and 1 feeder in a temperature-controlled room (maintained at 20 to 22°C) on a 16L:8D photo-period throughout the duration of study.

Productive Performance and Sample Collection

Egg production, egg weights, feed consumption and broken eggs (including those with double-yolk, soft-shell, cracked and broken egg) of were recorded daily. Feed conversion ratio (FCR) was calculated as the ratio of grams of total feed intake to grams of total egg weight. 48 h post the last tBHP injection (d 28), blood samples were collected from the wing vein (1 layer/replicate, 10 replicates/treatment). Blood samples were then centrifuged at 3,000 × g for 15 min, and then serum was stored at -20 °C till analysis. Thereafter, layers were sacrificed by CO2 suffocation, the intestinal (duodenum and jejunum) and ovarian tissues (ovary cortex) were taken and then stored at -80°C till gene expression analysis.

Egg Quality Characteristics

To determine the egg quality indices, egg samples (2 eggs/replicate, 20 eggs/treatment) were collected in three continuous days at the end of the supplementation period. The eggshell thickness was measured using a Peacock dial gauge (P-1 Model, Meg Co Ltd., Ozaki, Japan) after removing the shell membrane and it is represented as the average thickness of the upper, middle, and lower end of the shell. Eggshell strength was measured by eggshell force gauge model II (Robotmation Co., Ltd., Tokyo, Japan). Egg internal quality [including Haugh unit (HU), albumen height, and yolk color] were analyzed via an Egg Multi-tester (EMT-7300, Robotmation Co., Ltd., Tokyo, Japan). Eggshell was separated from the albumen and yolk, washed to remove residual albumen, and dried at 65°C for 4 h, then weighed. Albumen, yolk or eggshell ratio was calculated as 100 × [albumen weight, yolk or eggshell weight (g)/egg weight (g)].

Morphology of Intestinal Mucosa

Duodenum and jejunum mucosa (1 layer/replicate, 10 replicates/treatment) morphology were analyzed as described previously (Wang et al., 2021b). Briefly, the intestinal segments were fixed in 4% paraformaldehyde, then embedded in paraffin, and stained with hematoxylineosin. Villus height and crypt depth were measured in 40 × magnification with a digital camera microscope (BA400Digitl, McAudi Industrial, Group Co., Ltd). A total of 10 intact villi and crypts were randomly selected in each sample. Then, the data included villus height, crypt depth and their ratio (V/C) was calculated.

Serum Reproductive Hormones Assay

Serum concentration of estradiol, follicle stimulating hormone (FSH), anti-Müllerian hormone (AMH) and leptin were assessed by Radioimmunoassay Assay kits (RIA) (IBL International, Munich, Germany) according to the manufacturer’s instructions.

Antioxidant Enzyme Activity of Jejunum

Jejunum tissue samples were homogenized to analyze the antioxidant capacity. Commercial kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) were used to analyze the antioxidant capacity, including activities of superoxide dismutase (SOD), glutathione (GST), glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC) and the content of glutathione (GSH) and malondialdehyde (MDA) according to the manufacturer’s instructions.

Real-time PCR for Jejunum Intestinal Barrier, Inflammatory Cytokine, and Ovarian Function Related mRNA expression

Total RNA for jejunum mucosa and ovary tissue (1 layer/replicate, 10 replicates/treatment) was prepared using TRIzol reagent (TaKaRa, Dalian, China) and assessed using nucleic acid concentration analyzer NanoDrop 2,000 (Thermo Fisher, Waltham, MA, USA). Complementary DNA (cDNA) was synthesized was synthesized using PrimeScript RT reagent Kit with gDNA Erase (RR047 A, Takara, Dalian, China) following the manufacturer’s recommended protocol. ABI Prism 7000 Real-time Detection System using SYBR Premix Ex Taq II kit (TaKaRa, Dalian, China) were used to conduct the quantitative real-time PCR. The primer sequence for all the genes [interleukin-1β (IL-1β), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), zonula occluden-1 (ZO-1), steroidogenic acute regulatory protein (StAR), androgen receptor (AR), estrogen receptor 1 (ESR1), and activin a receptor type 1 (ACVR1)] are presented inTable 2. The house keeping gene (β–actin) was chosen in order to correct for variance in amount of RNA input in the reaction. The relative expression of each gene was calculated by using the 2ΔΔCT method (Livak and Schmittgen, 2001).

Table 1. Composition and nutrient level of basal diet (as-fed basis).

Item, % Amount
Corn 55.90
Soybean meal, 43% 25.35
Wheat bran 5.00
Soybean oil 3.00
Calcium Carbonate 8.15
Calcium Hydrophosphate 1.30
L-Lysine hydrochloride 0.13
DL-Methionine 0.20
Threonine 0.09
NaCl 0.30
Choline chloride, 50% 0.10
Vitamin and mineral premix1 0.48
Total 100.00
Analyzed nutrient levels, %
ME2, kcal/kg 2690.00
Crude protein 16.54
Calcium 3.53
Available phosphorus 0.32
Lysine 0.85
Methionine 0.42
Methionine + cysteine 0.61

1Provided per kilogram of diet: vitamin A, 10,000 IU; vitamin D3, 3,000 IU; vitamin E, 30 IU; vitamin K3, 4.8 mg; thiamin, 3.0 mg; riboflavin, 9.6 mg; pyridoxine, 6 mg; vitamin B12, 0.3 mg; folic acid, 1.5 mg; niacin, 60 mg; pantothenic acid, 18 mg; biotin,0.6 mg; iron, 60 mg; copper, 8 mg; manganese, 60 mg; zinc, 80 mg; selenium, 0.30 mg; iodine, 0.35 mg.

2Calculated according to NRC (1994).

Table 2. Related gene and primer information.1

Genes1 Orientation Primer Sequences (5′-3′) Product size Accession number
β-actin Forward GCTACAGCTTCACCACCACA 90 NM_205518.1
Reverse TCTCCTGCTCGAAATCCAGT
IL-1β Forward ACTGGGCATCAAGGGCTA 117 NM_205518.9
Reverse GGTAGAAGATGAAGCGGGTC
IL-6 Forward CAGGACGAGATGTGCAAGAA 98 NM_205518.10
Reverse GAGAGCTTCGTCAGGCATTT
TNF-α Forward AGATGGGAAGGGAATGAACC 139 XM_040647309.1
Reverse GGAAGGGCAACTCATCTGAA
NF-κB Forward GCTGCTTTGCACAGATGGA 130 NM_205134.1
Reverse CCTTTGCAAAACTGGTTGGT
Claudin-1 Forward GTCTTTGGTGGCGTGATCTT 117 NM_001013611.2
Reverse TCTGGTGTTAACGGGGTGTGA
Claudin-2 Forward CTTTGCTTCATCCCACTGGT 82 NM_001277622.1
Reverse TCAAATTTGGTGCTGTCAGG
Mucin-1 Forward CCGTGGTGAAGAGGATTTGT 126 XM_015279045.2
Reverse TTGGATGCAGTCACACCATT
Mucin-2 Forward ACCAAGCAGAAAAGCTGGAA 80 NM_001318434.1
Reverse AAATGGGCCCTCTGAGTTTT
ZO-1 Forward GGCAAGTTGAAGATGGTGGT 130 XM_01527898.2
Reverse ATGCCAGCGACTGAATTTCT
StAR Forward AGAGGAAGCCCTGCAGAAAT 92 NM_204686.2
Reverse TCAGCACTTTGTCTCCGTTG
AR Forward CCTGAATGAACTTGGGGAGA 93 NM_001040090.1
Reverse ATCTGGTCATCCACATGCAA
ESR1 Forward TTCAAGGGGAGGAATTTGTG 123 NM_205138.2
Reverse TGTCCAGAACACGGTGGATA
ACVR1 Forward ATTCCCAGAGCACAAACCAG 93 NM_001110204.1
Reverse GGATGGTTTCATCGAGCACT

1Abbreviation represents: IL-1β, interleukin-1β; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α; ZO-1, zonula occluden-1; StAR, steroidogenic acute regulatory protein; AR = androgen receptor; ESR1 = estrogen receptor 1; ACVR1 = activin a receptor type 1.

Statistical Analysis

Data were analyzed two-way analysis of variance (ANOVA) using GLM procedure of SAS 9.2 (SAS Institute, Cary, NC, USA) and GraphPad Prism (GraphPad Inc., La Jolla, CA, USA). The model included the main effects of tBHP injection and addition of resveratrol, as well as their interaction. The results are presented as mean ± SEM. Contrasts between treatments were evaluated by Tukey’s range test at a significance level of 0.05.

RESULTS

Production Performance

The hens challenged with tBHP presented lower egg-laying rate, feed intake, feed efficiency and higher broken egg rate compared no tBHP challenge group (Table 3; P(tBHP)<0.05). Dietary supplementation with RV significantly increased egg laying rate and decreased broken egg rate of layers irrespective of tBHP challenge (P(RV)=0.01). The RV were also observed to attenuated reduction in egg laying rate and feed intake, and decreased broken egg rate under t-BHP challenge (P(Interaction)≤0.01). No difference in average egg weight were noted among treatments (P>0.05).

Table 3. Effect of resveratrol on production performance of laying hens under oxidative stress

Item Laying rate, % Egg weight, g ADFI, g FCR Defective egg rate, %
tBHP RV
96.20b 55.85 107.43 1.91b 1.21b
+ 98.45a 55.32 105.74 1.92b 0.89b
+ 69.73d 53.71 94.69 2.55a 4.78a
+ + 87.45c 55.01 104.26 2.15b 1.47b
SEM 1.21 0.94 2.51 0.03 0.11
P-value <0.01 0.19 <0.01 0.02 0.01
P-value of main factor
tBHP <0.01 0.41 <0.01 0.02 <0.01
RV 0.01 0.29 0.11 0.51 0.01
tBHP × RV <0.01 0.89 0.02 0.16 0.01

a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 1 layer/replicate, 10 replicates/treatment. Abbreviations represented: tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); RV = 600 mg/kg resveratrol; ADFI = average daily feed intake; FCR = feed conversation ratio; SEM = standard error of the mean.

Egg Quality

Eggshell color (higher lightness, lower redness and yellowness values), strength, and thickness were lower in tBHP challenge (Table 4; P(tBHP)<0.05). A decease in the albumen height, Haugh unit, albumen relative weight and yolk color were observed in the tBHP challenge group compared to the no tBHP challenge group (P(tBHP)<0.05). The effect of RV was found to enhanced the eggshell quality (color, shell thickness and strength), albumen height and Haugh unit compared to no RV addition irrespective of tBHP challenge (P(RV)<0.05). The RV were also observed to increase eggshell color (lower lightness, higher redness and yellowness values), yolk color and albumen relative weight under tBHP challenge (P(Interaction)<0.05).

Table 4. Effect of resveratrol on egg quality of laying hens under oxidative stress

Item Eggshell color Eggshell strength, kg/cm3 Eggshell thickness, mm−2 Albumen height, mm Haugh unit York color Albumen relative weight, %
L* a* b*
tBHP RV
73.81b 7.71b 22.24b 4.23 0.404 7.94b 91.27b 6.31a 59.76a
+ 73.65b 9.05a 24.37a 4.84 0.421 8.32a 95.05a 6.19a 58.47a
+ 75.65a 6.56c 16.65c 2.73 0.359 6.59c 79.11c 5.53b 54.86b
+ + 72.04b 9.12a 23.52a 4.56 0.41 7.92b 91.32b 6.44a 56.71a
SEM 0.75 0.35 1.16 0.32 0.02 0.50 2.45 0.23 0.78
P-value <0.01 0.02 0.04 0.01 0.01 0.02 0.04 0.41 0.01
P-value of main factor
tBHP 0.02 0.03 <0.01 0.03 0.01 0.03 0.01 0.05 0.01
RV 0.34 <0.01 <0.01 <0.01 <0.01 0.01 0.01 0.57 0.39
tBHP × RV 0.02 0.05 0.01 0.14 0.23 0.11 0.14 <0.01 0.01

a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 1 layer/replicate, 10 replicates/treatment. Abbreviations represented: tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); RV = 600 mg/kg resveratrol; L* = lightness; a* = redness; b* = yellowness; SEM = standard error of the mean.

Serum Reproductive Hormone

A decrease in the serum concentration of estradiol, FSH, AMH and leptin were observed in the tBHP challenged group compared to the control one (Table 5; P(tBHP)<0.05). Feeding RV were found to increase FSH levels irrespective of tBHP challenge (P(RV)<0.05), while the increase in serum estradiol, AMH and leptin concentration were more pronounced when layers received RV supplemented diet under tBHP challenge (P(Interaction)<0.05).

Table 5. Effect of resveratrol on serum hormone of laying hens under oxidative stress

Item Estradiol, ng/L FSH, mmol/mL AMH, ng/L Leptin, ng/mL
tBHP RV
1317.56a 65.08a 9.30b 10.06
+ 1452.05a 67.42a 9.81a 9.26
+ 950.86b 43.89b 7.97c 9.03
+ + 1411.15a 57.07b 10.01a 9.30
SEM 187.27 3.85 0.22 0.22
P-value <0.01 0.01 0.03 0.69
P-value of main factor
tBHP 0.02 <0.01 <0.01 <0.01
RV 0.23 0.01 <0.01 <0.01
tBHP × RV <0.01 0.24 <0.01 <0.01

a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 1 layer/replicate, 10 replicates/treatment. Abbreviations represented: tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); RV = 600 mg/kg resveratrol; FSH = follicle-stimulating hormone; AMH = anti-Müllerian hormone; SEM = standard error of the mean.

Jejunal Morphology

No effect of tBHP challenge and RV supplementation were observed on crypt depth measured in this study (Table 6; P>0.05); However, the tBHP challenged layer demonstrated decreased villus height in duodenum and jejunum compared to layers in the control group (P(tBHP)<0.05). The duodenum villus height was enhanced and jejunum V/C ratio was reduced by dietary supplementation with RV irrespective of tBHP challenge (P(RV)<0.01). The increase in villus height and V/C ratio was more pronounced when layers received RV supplemented diet under tBHP challenge (P(Interaction)<0.01).

Table 6. Effect of resveratrol on egg quality of laying hens under oxidative stress

Item Duodenum Jejunum
Villus height Crypt depth V/C Villus height Crypt depth V/C
tBHP RV
1175.24b 137.14 9.09a 817.65a 106.36 8.30a
+ 1103.18b 126.29 7.09b 790.29a 95.22 7.21b
+ 897.69c 120.78 7.73b 726.74b 99.58 7.83a
+ + 1325.79a 121.19 9.29a 728.22b 97.41 6.99b
SEM 39.84 7.89 0.34 25.10 5.88 0.33
P-value <0.01 0.10 <0.01 <0.01 0.22 <0.01
P-value of main factor
tBHP 0.04 0.32 0.07 <0.01 0.61 0.09
RV <0.01 0.34 0.35 0.41 0.06 <0.01
tBHP × RV <0.01 0.29 <0.01 0.38 0.25 0.52

a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 1 layer/replicate, 10 replicates/treatment. Abbreviations represented: tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); RV = 600 mg/kg resveratrol; V/C = villus height to crypt depth ratio; SEM = standard error of the mean.

Jejunal Antioxidant Capacities

The activities of antioxidant enzymes (SOD, GSH-Px, T-AOC) and GSH levels in the jejunum were lower, while MDA level was higher in layers under tBHP challenge (Table 7; P(tBHP)<0.05). Dietary RV treatment increased SOD, GSH-Px and T-AOC activities, and reduced the concentration of MDA (P(RV) ≤0.05). The GST activity were not affected by either tBHP challenge or dietary RV supplementation (P>0.05).

Table 7. Effect of resveratrol on antioxidant capacity in jejunum of laying hens under oxidative stress

Item SOD, U/mg prot GSH, μmol/g prot GSH-Px, U/mg prot GST, U/mg prot T-AOC, nmol/mg prot MDA, nmol/mg
tBHP RV
110.12 98.36 210.11 88.79 2.14 4.11
+ 134.28 107.43 244.26 92.41 2.44 3.21
+ 78.19 34.33 107.14 78.77 1.14 7.24
+ + 124.79 88.18 200.91 77.24 2.69 4.01
SEM 12.24 14.24 21.41 13.79 <0.01 0.47
P-value <0.01 0.04 0.01 0.48 0.01
P-value of main factor
tBHP <0.01 0.01 0.02 0.14 0.01 0.02
RV 0.04 0.01 0.05 0.27 0.04 0.03
tBHP × RV 0.21 0.34 0.47 0.39 0.45 0.47

a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 1 layer/replicate, 10 replicates/treatment. Abbreviations represented: AR = average egg laying rate; tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); RV = 600 mg/kg resveratrol; SOD = total superoxide dismutase; GSH = glutathione; GSH-Px = glutathione peroxidase; GST = glutathione S-transferase; T-AOC = total antioxidant capacity; MDA = malondialdehyde; SEM = standard error of the mean.

Jejunal Inflammatory Cytokine and Barrier Integrity Related Gene Expression

Layers under tBHP challenge up-regulated mRNA expression of pro-inflammatory cytokine (including IL-1β, IL-6 and TNF-α) and its up-streaming nuclear factor NF-κB (Figure 1; P(tBHP)<0.05). Dietary RV supplementation down-regulated mRNA gene expression of IL-1β, IL-6, TNF-α and NF-κB (P(RV) ≤0.05).

Figure 1

Figure 1. Effect of dietary resveratrol supplementation on inflammatory cytokine mRNA gene expression in jejunum. (A) IL-1β, (B) IL-6, (C) TNF-α, and (D) NF-κB mRNA expression. Abbreviations indicated: RV = 600 mg/kg resveratrol, tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW), IL-1β = interleukin-1 β, IL-6 = interleukin-1, TNF-α = tumor necrosis factor alpha, NF-κB = nuclear factor-kappa B.

Moreover, compared with the layers receive no challenge, layers under t-BHP challenge had lower mRNA expression of barrier-related proteins (claudin-1, claudin-2, Mucin-1, and Occludin) (Figure 2; P(tBHP)<0.05) in jejunum mucosa. As expected, dietary RV up-regulated mRNA expression of intestinal barrier related protein (claudin-1, claudin-2, Mucin-1, and Occludin) (P(RV) ≤0.05). Mucin-2 and ZO-1 were not affected by either tBHP or RV addition (P>0.05).

Figure 2

Figure 2. Effect of dietary resveratrol supplementation on intestinal barrier-related mRNA gene expression in jejunum. (A) Claudin-1 (B) Claudin-2, (C) Mucin-1, (D) Mucin-2, (E) ZO-1, and (F) Occludin mRNA expression. Abbreviations indicated: RV = 600 mg/kg resveratrol, tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); ZO-1 = zonula occluden-1.

Ovarian Reproductive Receptor Gene Expression

As shown in Figure 3, dietary supplementation with RV increased reproductive receptor mRNA expression, including AR, ESR1, ACVR1 and StAR compared with no addition (P(RV) ≤0.01). No effects of tBHP were found on reproductive receptor gene expression (P(tBHP)>0.05).

Figure 3

Figure 3. Effect of dietary resveratrol supplementation on ovarian reproduction related hormone receptor mRNA gene expression. (A) Androgen receptor, (B) Estrogen receptor 1, (C) Activin a receptor type 1, and (D) Steroidogenic acute regulatory protein mRNA expression. Abbreviations indicated: RV = 600 mg/kg resveratrol, tBHP = intraperitoneal injection of tert-butyl hydroperoxide (tBHP) (0 or 800 μmol/kg BW); ACVR1 = activin a receptor type 1.

DISCUSSION

Oxidative stress induces apoptosis and affects cellular homeostasis, which was demonstrated to decrease ovarian function by inducing follicle atresia (Shen et al., 2017; Cao et al., 2018). In this study, we confirmed that the oxidative stress induced by injection of tBHP significantly reduced egg production rate and feed intake of laying hens; moreover, the administration of RV diet improved the egg production performance of laying hens in present study. Oxidative stress resulted from environmental toxicant and other stressors were reported to damage the health and production performance of layers (Devine et al., 2012; Wang et al., 2020b; Abbs et al., 2020). Tert-butyl hydroperoxide (t-BHP) known to cause peroxidation of membrane lipids and deplete cellular GSH and is commonly used as a model substance for evaluation of mechanisms of cellular alterations resulting from oxidative stress in cells and tissues (Kučera et al., 2014). The tBHP were found to successfully induce oxidative damage and decreased laying performance in our previous study (Wang et al., 2021b). In accordance with our current study, oxidative stress induced by high levels of molybdenum and vanadium were also led to egg production reduction and the addition of antioxidants (tea polyphenols) was able to reverse this effect by improving the antioxidant capacity and intestinal health in layers (Yuan et al., 2017; Wang et al., 2018; Wang et al., 2021b). Studies in mammals have found that oxidative stress can reduce the number of follicles in each stage of the ovarian cycle and impair ovarian function (Miyamoto et al., 2010; Abou-Seif et al., 2001; Brannian and Hansen, 2002). Additionally, previous studies have also reported that oxidative stress decreases hormone secretion (including lower estradiol, FSH, LH and IGF-1) and impairs the glutathione redox cycle (Miyamoto et al., 2010; Yu et al., 2019). Leptin were reported to exert an important role in the regulation of ovarian folliculogenesis indirectly by controlling of luteinizing hormone and FSH secretion (Brannian and Hansen, 2002). Similarly, the OS decreased estradiol, FSH, AMH and leptin levels in the current study, which explain the reduction in egg laying rate. However, the literature about oxidative stress on the ovary function of poultry is not well elucidated, which needs to be explored in future studies. Plant polyphenols were chosen in laying hens’ diet to increase production performance recently due to its antioxidative, antiaging, reducing antiinflammation, and antimicrobial properties. Zhang et al. (2019) found that 200 mg/kg RV supplementation improved feed intake, egg laying rate and feed efficiency of layers. Liu et al. (2014) also reported that RV improves growth performance and reduces oxidative stress in heat-stressed blacked-boned chickens (Liu et al., 2014). This may because the RV can increase the health status of laying hens by improving the health status of intestine, ovary and oviduct (enhance antioxidant capacities, decreasing inflammation) (Reis et al., 2019).

In the current study, tBHP challenge were found to result in reduction in eggshell quality (including pale shell color, lower thickness and strength) and albumen quality. Moreover, the RV treatment resulted in a higher shell color in OS-challenged birds, which is in agreement with previous observation where the decrease in oxidative stress-induced shell color was reversed by antioxidant supplementation studies (Yuan et al., 2016; Wang et al., 2016).The eggshell pigmentation has been widely used as a potential indicator for stress and disease condition in commercial laying hens (Samiullah et al., 2015). It is evident that stress stimuli, including environmental stressors (heat stress, crowding, fear, etc.) and dietary hazards (heavy metals, mycotoxins, toxicants, etc.) led to pale coloration eggshell eggs (Yuan et al., 2016; Wang et al., 2016; Wang et al., 2018; Wang et al., 2020b). Ma et al. (2021) also reported that dietary arsenic supplementation (40.67 mg/kg) would lead to oxidative stress to reduce egg laying rate, albumen height, Haugh unit, and eggshell strength of laying hens. The green tea polyphenol epigallocatechin-3-gallate were found to increase eggshell color by increasing morphology and antioxidant capacity of uterus in layers exposed to oxidative stress (induced by 5 or 10 mg/kg vanadium) in previous studies (Yuan et al., 2016; Wang et al., 2018). Resveratrol also can affect calcium metabolism (Sahin et al., 2010). Liu et al. (2005) showed that resveratrol (0.7 mg/kg) supplementation increased bone mineral density and inhibited femur calcium loss associated with estrogen deficiency in ovariectomized rats. Zhang et al. (2019) found that 400 mg/kg RV extent the egg shelf lives (increase albumen quality) during storage. Moreover, we found that egg yolk color was decreased by tBHP challenge and recovered by RV supplementation. Egg yolk color is produced by oxycarotenoids, commonly known as xanthophyll pigments, derived from the hen’s feed. It has been reported that the oxycarotenoids can be oxidized by agents such as peroxides and trace minerals. Previous studies have suggested that antioxidants, such as vitamin E, quercetin, selenium were found to increase the magnitude of the yolk color and antioxidant capacities of eggs (Surai et al., 2000; Amevor et al., 2021). However, Sahin et al. (2010) didn’t observe any effect of RV (200 or 400 mg/kg) on feed intake, egg production, inner and outer egg quality indicators in quails. The discrepancy may rely on the difference poultry strains, physiology stage and the stress model they are exposed to.

The intestinal epithelium, composed of single layer of cells, sits at the interface between an organism and its luminal environment, and as such is prone to oxidative stress (Circu et al., 2012). Intestinal morphology determines the nutrient absorption capacity and villus height is generally recognized as a good indicator for intestinal health. An increase in villus height indicates an increased absorption surface and higher capability of absorption available nutrients, whereas deeper crypt depth indicates that the villi in the small intestinal mucosa are atrophied (Celi et al., 2019). ROS, such as hydrogen peroxide and nitric oxide, disrupt tight junctions (TJs) and elevate paracellular permeability in vitro. TJs (such as zonula occludens-1 (ZO-1), occludin, and claudin-1 and -4) regulate the paracellular transport of ions, molecules, and water, and it determined the integrity of epithelia cell and mucus gel layer (Moretó and Pérez-Bosque, 2009; Ulluwishewa et al., 2011). In this study, we found that OS led to down-regulation of intestinal barrier associated protein (claudin-1, claudin-2, mucin-1, occludin). Also, OS induced inflammation (indicated by higher mRNA expression of pro-inflammatory cytokine, such as IL-1β, IL-6 and TNF-α) and its up-streaming nuclear factor NF-κB), decreased the villus height and antioxidant capacities of small intestine, as demonstrated by lower activities of antioxidant enzymes, SOD, GSH-Px and T-AOC, and higher corresponding levels of MDA. Wang et al. (2020) also reported that layers exposed to high stocking density stress also led to deceases in villus height of small intestine. RV has been evident to restrain oxidative stress and alleviate inflammatory responses in a rat model of polycystic ovary syndrome (Sadi et al., 2015). It also plays several roles in antioxidative and anti-inflammatory pathways and ameliorates metabolic syndrome (Javkhedkar et al., 2015). Xing et al. (2019) and Wang et al. (2021a) reported that RV (400 mg/kg) supplementation decreased oxidative stress in fatty liver hemorrhagic syndrome by enhancing antioxidant enzymes (Nrf2, SOD-1 and HO-1) and decreasing inflammatory cytokines (NF-κB, IL-1β, IL-6 and TNF-α) mRNA expression in ovary. Intestinal oxidative stress produces pro-inflammatory cytokines, which increase mucus layer permeability, leading to intestinal and systemic inflammation. Mucosal oxidative stress would result from the disruption of these unique redox control nodes, and subsequent contribute to the development of inflammation and other intestinal pathology. Yang et al. (2021) also reported that dietary supplementation with 400 mg/kg RV protect against oxidative damage and inflammation injury (induced by heat stress) indicated by improving tight junction protein (claudin 1, occludin) mRNA expression, antioxidant enzyme activities (SOD and CAT) and reducing the secretion of IL-1β in duck jejunum.

In the current study, we found that dietary supplementation with RV increased mRNA expression of AR, ESR1, ACVR1 and StAR. Androgen is an important regulator of prostate gland development and function, including proliferation, differentiation, maintenance (Chang et al., 1988). The androgen receptor (AR) is a crucial mediator of androgen action and a ligand-dependent transcription factor that belongs to the nuclear steroid hormone receptor super-family. Resveratrol has been reported to exert estrogenic effects, increasing uterine and ovarian wet weight (Henry and Witt, 2002; Wang et al., 2021). Han et al. (2021) reported that RV increased estrogen receptor 2 (ESR2) expression. This may also explain the increasing effect of RV on egg production performance. Also, Morita et al. (2012) found that resveratrol increased the expression of LH receptor and StAR mRNA expression in rat GCs, suggesting a possibility that resveratrol may promote steroidogenesis and luteinization (a process of terminal differentiation of granulosa cells) in the ovary of rat. StAR is known to govern the rate-limiting step in steroidogenesis, which is the translocation of cholesterol from the outer to the inner mitochondrial membrane (Kiriakidou et al., 1996; Devoto et al., 2002). However, other studies demonstrated that RV depressed the AR transcriptional activity in cancer cells and in ovarian follicle (Bowers et al., 2000; Ozatik et al., 2020). The discrepancies may due to the different animal type, stress model and RV levels used the study. As the oxidative stress is the general mechanism for aging and hazardous toxicant in animals, further study is needed to elucidate the mechanism within the response of RV in oxidative stress.

CONCLUSION

These results indicated that tBHP (intraperitoneal injection of 800 μmol/kg BW of tBHP) induced oxidative stress in layers, which may lead to reduction in production performance, egg quality, intestinal health and induced ovarian inflammation. Dietary supplementation with 600 mg/kg RV was able to maintain intestinal and ovarian function and mitigate the negative impact of tBHP challenge on production performance and egg quality.

Conflict of interest

No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. I would like to declare on behalf of my co-authors that the work described was original research that has not been published previously, and not under consideration for publication elsewhere, in whole or in part. All the authors listed have been approved the manuscript that is enclosed.

Uncited References

Abbas et al., 2020, Jang et al., 1997, Abou-Seif and Youssef, 2001, Muhammad et al., 2021, Surai, 2000, Wang et al., 2018, Wang et al., 2020a, Circu and Aw, 2012

Acknowledgement

We are grateful for the following projects, National Natural Science Foundation of China (Grant No. 31872792), the National Key Research and Development Program of China (Grant No. 2021YFD1300204) and Sichuan Provincial Science and Technology Projects (Grant No. 2019YFH0062) for financial support.

References

Bowers et al., 2000

J.L. Bowers, W. Tyulmenkov, S.C. Jernigan, C.M. Klinge

Resveratrol acts as a mixed agonist/antagonist for estrogen receptors alpha and beta
Endocrinology, 141 (10) (2000), pp. 3657-3667

Brannian and Hansen, 2002

J.D. Brannian, K.A. Hansen

Leptin and ovarian folliculogenesis: implications for ovulation induction and ART outcomes
Semin. Reprod. Med., 20 (2) (2002), pp. 103-112

Cao et al., 2018

Y. Cao, M. Shen, Y. Jiang, S.C. Sun, H. Liu

Melatonin reduces oxidative damage in mouse granulosa cells via restraining JNK-dependent autophagy
Reproduction, 155 (2018), pp. 307-319

Celi et al., 2019

P. Celi, V. Verlhac, E. PerezCalvo, J. Schmeisser, A.M. Kluenter

Biomarkers of gastrointestinal functionality in animal nutrition and health
Anim. Feed. Sci. Technol., 250 (2019), pp. 9-31

Chang et al., 1988

C.S. Chang, J. Kokontis, S.T. Liao

Molecular cloning of human and rat complementary DNA encoding androgen receptors
Science, 240 (4850) (1988), pp. 324-326

Circu and Aw, 2012

M.L. Circu, T.Y. Aw

Intestinal redox biology and oxidative stress
Semin. Cell Dev. Biol., 23 (7) (2012), pp. 729-737

Devine et al., 2012

P.J. Devine, S.D. Perreault, U. Luderer

Roles of reactive oxygen species and antioxidants in ovarian toxicity
Biol. Reprod., 86 (2) (2012), p. 27

Devoto et al., 2002

L. Devoto, P. Kohen, M. Vega, O. Castro. R. R. Gonzalez, I. Retamales, P. Carvallo, L.K. Christenson, J.F. Strauss

Control of human luteal steroidogenesis
Mol. Cell Endocrinol., 186 (2) (2002), pp. 137-141

Feng et al., 2017

Z.H. Feng, J.G. Gong, G.X. Zhao, X. Lin, Y.C. Liu, K.W. Ma

Effects of dietary supplementation of resveratrol on performance, egg quality, yolk cholesterol and antioxidant enzyme activity of laying hens
Br. Poult. Sci., 58 (5) (2017), pp. 544-549

Gupta et al., 2006

R.K. Gupta, K.P. Miller, J.K. Babus, J. A

Flaws methoxychlor inhibits growth and induces atresia of antral follicles through an oxidative stress pathway
Toxicol. Sci., 93 (2006), pp. 382-392

Han et al., 2021

S. Han, A.F. Cicek, A. Tokmak, T.Y. Ustun, N.E. Gokay, M.O. Uludag, M.A. Demirel

Effect of resveratrol on receptor expression and serum levels of estrogen and progesterone in the rat endometritis model
Reproduct. Sci., 28 (2021), pp. 2610-2622

Henry and Witt, 2002

L.A. Henry, D.M. Witt

Resveratrol: phytoestrogen effects on reproductive physiology and behavior in female rats
Horm. Behav., 41 (2) (2002), pp. 220-228

Jang et al., 1997

M. Jang, L. Cai, G.O. Udeani, K.V. Slowing, C.F. Thomas, C.W. Beecher, H.H. Fong, N.R. Farnsworth, A.D. Kinghorn, R.G. Mehta, R.C. Moon, J.M. Pezzuto

Cancer chemopreventive activity of resveratrol, a natural product derived from grapes
Science, 275 (5297) (1997), pp. 218-220

Javkhedkar et al., 2015

A.A. Javkhedkar, Y. Quiroz, B. Rodriguez-Iturbe, N.D. Vaziri, M.F. Lokhandwala, A.A. Banday

Resveratrol restored Nrf2 function, reduced renal inflammation, and mitigated hypertension in spontaneously hypertensive rats
Am. J. Physiol. Regul. Integr. Comp. Physiol., 308 (2015), pp. R840-R846

Kiriakidou et al., 1996

M. Kiriakidou, J.M. McAllister, T. Sugawara, J.F. Strauss

Expression of steroidogenic acute regulatory protein (StAR) in the human ovary
J. Clin. Endocrinol. Metab., 81 (11) (1996), pp. 4122-4128

Kučera et al., 2014

O. Kučera, R. Endlicher, T. Roušar, T.H. Lotková, T. Garnol, Z. Drahota, Z. Cervinková

The effect of tert-butyl hydroperoxide-induced oxidative stress on lean and steatotic rat hepatocytes in vitro
Oxid. Med. Cell Longev., 2014 (2014), Article 452506

Li et al., 2020

G.M. Li, L.P. Liu, B. Yin, Y.Y. Liu, W.W. Dong, S. Gong, J. Zhang, J.H. Tan

Heat stress decreases egg production of laying hens by inducing apoptosis of follicular cells via activating the FasL/Fas and TNF-α systems
Poult. Sci., 99 (11) (2020), pp. 6084-6093

Li and Liu, 2018

N. Li, L. Liu

Mechanism of resveratrol in improving ovarian function in a rat model of premature ovarian insufficiency
J. Obstet. Gynaecol. Res., 44 (8) (2018), pp. 1431-1438

Li et al., 2018

Y.R. Li, S. Li, C. Lin

Effect of resveratrol and pterostilbene on aging and longevity
Biofactors, 44 (1) (2018), pp. 69-82

Liguori et al., 2018

I. Liguori, G. Russo, F. Curcio, G. Bulli, L. Aran, D. Della-Morte, G. Gargiulo, G. Testa, F. Cac-ciatore, D. Bonaduce, P. Abete

Oxidative stress, aging, and diseases
Clin. Interv. Aging., 13 (2018), pp. 757-772

Liu et al., 2014

L.L. Liu, J.H. He, H.B. Xie, Y.S. Yang, J.C. Li, Y. Zou

Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens
Poult. Sci., 93 (1) (2014), pp. 54-62

Liu et al., 2013

M. Liu, Y. Yin, X. Ye, M. Zeng, Q. Zhao, D.L. Keefe, L. Liu

Resveratrol protects against age-associated infertility in mice
Hum. Reprod., 28 (3) (2013), pp. 707-717

Liu et al., 2021a

W.C. Liu, B.H. Ou, Z.L. Liang, R. Zhang, Z.H. Zhao

Algae-derived polysaccharides supplementation ameliorates heat stress-induced impairment of bursa of Fabricius via modulating NF-κB signaling pathway in broilers
Poult. Sci., 100 (8) (2021), Article 101139

Liu et al., 2021b

W.C. Liu, Y.R. Zhu, Z.H. Zhao, P. Jiang, F.Q. Yin

Effects of dietary supplementation of algae-derived polysaccharides on morphology, tight junctions, antioxidant capacity and immune response of duodenum in broilers under heat stress
Animals, 11 (8) (2021), p. 2279

Livak and Schmittgen, 2001

K.J. Livak, T.D. Schmittgen

Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta C(T) method
Method, 25 (2001), pp. 402-408

Ma et al., 2021

Y. Ma, Y. Shi, Q. Wu, W. Ma

Dietary arsenic supplementation induces oxidative stress by suppressing nuclear factor erythroid 2-related factor 2 in the livers and kidneys of laying hens
Poult. Sci., 100 (2) (2021), pp. 982-992

Mishra and Jha, 2019

B. Mishra, R. Jha

Oxidative Stress in the Poultry Gut: Potential Challenges and Interventions. Front
Vet. Sci., 6 (2019), p. 60

Miyamoto et al., 2010

K. Miyamoto, F.E. Sato, E. Kasahara, M. Jikumaru, K. Hiramoto, H. Tabata, M. Katsuragi, S. Odo, K. Utsumi, M. Indoue

Effect of oxidative stress during repeated ovulation on the structure and functions of the ovary, oocytes, and their mitochondria. Free Radic
Biol. Med., 49 (2010), pp. 674-681

Moretó and Pérez-Bosque, 2009

M. Moretó, A. Pérez-Bosque

Dietary plasma protein, the intestinal immune system, and the barrier functions of the intestinal mucosal
J. Anim. Sci., 87 (2009), pp. E92-E100

Morita et al., 2012

Y. Morita, O. Wada-Hiraike, T. Yano, A. Shirane, M. Hirano, H. Hiraike, S. Koyama, H. Oishi, O. Ylshino, Y. Miyamoto, K. Sone, K. Oda, S. Nakagawa, K. Tsutsui, Y. Taketani

Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: an implicative role of SIRT1 in the ovary
Reprod. Biol. Endocrinol., 10 (2012), p. 14

Muhammad et al., 2021

A.I. Muhammad, D.A.A. Mohamed, L.T. Chwen, H. Akit, A.A. Samsudin

Effect of sodium selenite, selenium yeast, and bacterial enriched protein on chicken egg yolk color, antioxidant profiles, and oxidative stability
Foods, 10 (4) (2021), p. 871

Nunes et al., 2018

S. Nunes, F. Danesi, D.D. Rio, P. Silva

Resveratrol and inflammatory bowel disease: the evidence so far
Nutr. Res. Rev., 31 (1) (2018), pp. 85-97

Ochiai and Kuroda, 2019

A. Ochiai, K. Kuroda

Preconception resveratrol intake against infertility: friend or foe?
Reproductive Medicine in Biology, 19 (2) (2019), pp. 107-113

Ozatik et al., 2020

F.Y. Ozatik, O. Ozatik, S. Yigitaslan, B. Kaygisiz, K. Erol

Do Resveratrol and Dehydroepiandrosterone Increase Diminished Ovarian Reserve?
Eurasian J. Med., 52 (1) (2020), pp. 6-11

Pizzino et al., 2017

G. Pizzino, N. Irrera, M. Cucinotta, G. Pallio, F. Mannino, V. Arcoraci, F. Squadrito, D. Altavilla, A. Bitto

Oxidative stress: harms and benefits for human health
Oxid. Med. Cell Longev., 2017 (2017), Article 8416763

Reis et al., 2019

J.H. Reis, R.R. Gebert, M. Barreta, M.M.M. Boiago, C.F. Souza, M.D. Baldissera, I.D. Santos, R. Wagner, L.V. Laporta, L.M. Stefani, A.S. Da Silva

Addition of grape pomace flour in the diet on laying hens in heat stress: impacts on health and performance as well as the fatty acid profile and total antioxidant capacity in the egg
J. Thermal Biol., 80 (2019), pp. 141-149

Sadi et al., 2015

G. Sadi, M.B. Pektas, H.B. Koca, M. Tosun, T. Koca

Resveratrol improves hepatic insulin signaling and reduces the inflammatory response in streptozotocin-induced diabetes
Gene, 270 (2015), pp. 213-230

Sahin et al., 2010

K. Sahin, F. Akdemir, C. Orhan, M. Tuzcu, A. Hayirli, N. Sahin

Effect of dietary resveratrol supplementation on egg production and antioxidant status
Poult. Sci., 89 (6) (2010), pp. 1190-1198

Samiullah et al., 2015

S. Samiullah, J.R. Roberts, K. Chousalkar

Eggshell color in brown -egg laying hens-a review
Poult. Sci., 94 (2015), pp. 2566-2575

Shen et al., 2012

M. Shen, F. Lin, J. Zhang, Y. Tang, W.K. Chen, H. Liu

Involvement of the up-regulated FoxO1 expression in follicular granulosa cell apoptosis induced by oxidative stress
J. Biol. Chem., 287 (2012), pp. 25727-25740

Shen et al., 2017

M. Shen, Y. Jiang, Z. Guan, Y. Cao, L. Li, H. Liu, S.C. Sun

Protective mechanism of FSH against oxidative damage in mouse ovarian granulosa cells by repressing autophagy
Autophagy, 13 (8) (2017), pp. 1364-1385

Surai, 2000

P.F. Surai

Effect of selenium and vitamin E content of the maternal diet on the antioxidant system of the yolk and the developing chick
Br. Poult. Sci., 41 (2000), pp. 235-243

Ulluwishewa et al., 2011

D. Ulluwishewa, R.C. Anderson, W.C. McNabb, P.J. Moughan, J.M. Wells, N.C. Roy

Regulation of tight junction permeability by intestinal bacteria and dietary components
J. Nutr., 141 (2011), pp. 769-776

Wang et al., 2016

J.P. Wang, K.R. He, X.M. Ding, Y.H. Luo, S.P. Bai, Q.F. Zeng, Z.W. Su, Y. Xuan, K.Y. Zhang

Effect of dietary vanadium and vitamin C on egg quality and antioxidant status in laying hens
J. Anim. Physiol. Anim. Nutr., 100 (2016), pp. 440-447

Wang et al., 2021

J. Wang, R. Jia, H. Gong, P. Celi, Y. Zhuo, X. Ding, S. Bai, Q. Zen, H. Yin, S. Xu, J. Liu, X. Mao, K. Zhang

The effect of oxidative stress on the chicken ovary: involvement of microbiota and melatonin interventions
Antioxidants, 10 (2021), p. 1422

Wang et al., 2020

J. Wang, L. Qiu, H. Gong, P. Celi, L. Yan, X. Ding, S. Bai, Q. Zeng, X. Mao, S. Xu, C. Wu, K. Zhang

Effect of dietary 25-dydroxycholecalciferol supplementation and high stocking density on performance, egg quality, and tibia quality in laying hens
Poult. Sci., 99 (2020), pp. 2608-2615

Wang et al., 2018

J. Wang, X. Qian, Q. Gao, C. Lv, J. Xu, H. Jin, H. Zhu

Quercetin increases the antioxidant capacity of the ovary in menopausal rats and in ovarian granulosa cell culture in vitro
J. Ovarian Res., 11 (2018), p. 51

Wang et al., 2019

J. Wang, Z.Q. Yang, P. Celi, L. Yan, X.M. Ding, S.P. Bai, Q.F. Zeng, X.B. Mao, B. Feng, S.Y. Xu, K.Y. Zhang

Alteration of the antioxidant capacity and gut microbiota under high levels of molybdenum and green tea polyphenols in laying hens
Antioxidants (Basel), 8 (2019), p. 503

Wang et al., 2018

J. Wang, Z. Yuan, K. Zhang, X. Ding, S. Bai, Q. Zeng, H. Peng, P. Celi

Epigallocatechin-3-gallate protected vanadium-induced eggshell depigmentation via P38-Nrf/HO-1 signaling pathway in laying hens
Poult. Sci., 97 (2018), pp. 3109-3118

Wang et al., 2020a

X. Wang, C. Xing, F. Yang, S. Zhou, G. Li, C. Zhang, H. Cao, G. Hu

Abnormal expression of liver autophagy and apoptosis-related mRNA in fatty liver haemorrhagic syndrome and improvement function of resveratrol in laying hens
Poult. Sci., 49 (2) (2020), pp. 171-178

Xing et al., 2019

C. Xing, Y. Wang, X. Dai, F. Fang, J. Luo, P. Liu, C. Zhang, H. Cao, G. Hu

The protective effects of resveratrol on antioxidant function and the mRNA expression of inflammatory cytokines in the ovaries of hens with fatty liver hemorrhagic syndrome
Poult. Sci., 99 (2) (2019), pp. 1019-1027

Yang et al., 2021Yang, C., P. Luo, S. J. Chen, Z. C. Deng, X. L. Fu, D. N. Xu, Y. B. Tian, Y. M. Huang, and W. J. Liu. 2021. Resveratrol sustains intestinal barrier integrity, improves antioxidant capacity, and alleviates inflammation in the jejunum of ducks exposed to acute heat stress.

Yu et al., 2019

H. Yu, M. Huang, Y. Wang, S. Rodeni, Q. Wei, W. Wang, D. Mao

Sodium arsenite injection induces ovarian oxidative stress and affects steroidogenesis in rats
Biol. Trace Elem. Res., 189 (2019), pp. 186-193

Yuan et al., 2016

Z.H. Yuan, K.Y. Zhang, X.M. Ding, Y.H. Luo, S.P. Bai, Q.F. Zeng, J.P. Wang

Effect of tea polyphenols on production performance, egg quality, and hepatic antioxidant status of laying hens in vanadium-containing diets
Poult. Sci., 95 (7) (2016), pp. 1709-1717

Zhang et al., 2019

C. Zhang, X. Kang, T. Zhang, J. Huang

Positive effects of resveratrol on egg-laying ability, egg quality, and antioxidant activity in hens
J. Appl. Poult. Res., 28 (4) (2019), pp. 1099-1105

Zhou et al., 2021

D.D. Zhou, M. Luo, S.Y. Huang, A. Saimaiti, A. Shang, R.Y. Gan, H.B. Li

Effects and mechanisms of resveratrol on aging and age-related diseases
Oxid. Med. Cell Longev., 2021 (2021), Article 9932218